r - How to transform a string vector to character array - 


> head(base_mat)                                                                                                      v1 1 ctgcagaggctatttcctggaatgaatcaacgagtgaaacgaataactctatggtgactgaattcatttttctgggtctctctgattctcaggaactccag 2 tctgctgtgaggcagacgttgggactgtagaggctgacgggaggcagaggctgggcctggaggggccaccaagatgcaggagctgggcctggagaggctgc 3 cataatcacaatttcctccccattttcttagttctcataattttagccacagcccagttggctggaccaatggatggagagaatcactcagtggtatctga 4 tcagataccactgagtgattctctccatccattggtccagccaactgggctgtggctaaaattatgagaactaagaaaatggggaggaaattgtgattatg 5 ccaaatacctgcacagtatgtatgataaatgcatatgataaagtaaaaaaaaaaatagcacacactgaaagaaagccaacagaagagggcactgggcatgg 6 ttgagctgggattatagttgacatttcattataatatattagctattctagactttatgcatttatgtaaagttttctttgttgcactttaagttctgtga

i want transform character array, strsplit() function doesn't work.

> strsplit(head(base_mat),split="") error in strsplit(head(base_mat), split = "") : 非字符参数

i want every column of string variable of data.frame. such as

v1    v2    v3 c     t     g   ... t     c     t ...

how that?

thanks @imo reminding me factor variable question , @jogo solution. problem can fixed follows.

> options(stringsasfactors = false) > x <- c("ctgcagaggctatttcctggaatgaatcaacgagtgaaacgaataac","ctgcagaggctatttcctggaatgaatcaacgagtgaaacgaataac") > x <- data.frame(x) > strsplit(x, "") error in strsplit(x, "") : non-character argument > strsplit(x[,1], "") [[1]]  [1] "c" "t" "g" "c" "a" "g" "a" "g" "g" "c" "t" "a" [13] "t" "t" "t" "c" "c" "t" "g" "g" "a" "a" "t" "g" [25] "a" "a" "t" "c" "a" "a" "c" "g" "a" "g" "t" "g" [37] "a" "a" "a" "c" "g" "a" "a" "t" "a" "a" "c"  [[2]]  [1] "c" "t" "g" "c" "a" "g" "a" "g" "g" "c" "t" "a" [13] "t" "t" "t" "c" "c" "t" "g" "g" "a" "a" "t" "g" [25] "a" "a" "t" "c" "a" "a" "c" "g" "a" "g" "t" "g" [37] "a" "a" "a" "c" "g" "a" "a" "t" "a" "a" "c"

Comments

Post a Comment

Popular posts from this blog

PHP and MySQL WP -

i trying accomplish 2 things here code. writing php directly wp page using insert php plugin. 1) query mysql database , return results 1 column 4 columns. 2) make each result own hyperlink directs user new wp page runs new query on page. i able query show results , turn results dynamic hyperlink, cannot formatting down. right returns result 1 column. here have: [insert_php] $servername = "localhost"; $username = "login"; //edited privacy $password = "password"; //edited privacy $database = "database"; //edited privacy // create connection $conn = new mysqli($servername, $username, $password, $database); // check connection if ($conn->connect_error) { die("connection failed: " . $conn->connect_error); } echo "connected successfully"; //get results database $result = mysqli_query($conn,"select mine mines order mine"); $all_property = array(); //declare array saving property //showing proper...
Read more

android - InAppBilling registering BroadcastReceiver in AndroidManifest -

i'm implementing inapp billing in android app. works well, however, i'm trying decouple broadcast receiver activity manifest. suggestion in android's trivialdrive sample: // important: dynamically register broadcast messages updated purchases. // register receiver here instead of <receiver> in manifest // because call getpurchases() @ startup, therefore can ignore // broadcasts sent while app isn't running. // note: registering listener in activity bad idea, done here // because sample. regardless, receiver must registered after // iabhelper setup, before first call getpurchases(). currently there's class extends broadcastreceiver : public class iabbroadcastreceiver extends broadcastreceiver { /** * intent action receiver should filter for. */ public static final string action = "com.android.vending.billing.purchases_updated"; private final iabbroadcastlistener mlistener; public iabbroadcastreceiver(iabbroadcastlistener listener) { m...
Read more

go - golang pprof for c library code -

i have been trying profile golang application pprof, seems details of c code(linked static library) missed in output result. flame graph from frame graph can see c code time consuming reported within "runtime._externalcode", no details @ all. , sure static library compiled debug enable. so there way make pprof details(like stack trace) of 3rd party c code? or there other golang profiling tool this?
Read more